BCH 5425 Molecular Biology and Biotechnology

Spring 1998

1. Regarding protein assays:

A. (10 points) What are the criteria which an ideal protein assay should meet?

B. (10 points) Few assays are able to meet all desired criteria. For each the criteria listed in A above, describe the consequences if the assay does not meet the criteria

2. (20 points) The following data is from an ammonium sulfate precipitation experiment of a crude extract of E. coli cells which are expressing a protein of interest. The starting sample contains 15.5 mgs of total protein. An assay for the protein of interest indicates the starting sample has 153 units of activity. Using this information, fill in the blanks in the table below.

3. (10 points) Using the information from the above table, indicate how you could incorporate an ammonium sulfate precipitation step in a purification scheme for this particular protein of interest under the following restrictions:

A. The E. coli expression system does not make a lot of the protein of interest. Therefore you need to achieve a better than 90% yield for this step.

B. The E. coli system efficiently expresses the protein of interest. Therefore, yield is not a concern and you need to maximize purity.

4. (15 points) Provided with the following characteristics of a given protein and chromotographic resins, indicate the appropriate resin to try to use to purify the protein. (Assume the buffer for such experiments is pH 7.0) DRAW A LINE FROM THE PROTEIN TO THE RESIN.

Protein Resin

A. pI = 5.6 CM-52 (Carboxymethyl cellulose)

B. pI = 3.8 DE-52 (Diethylaminoethyl cellulose)

C. pI = 8.7 SP-sephadex (Sulphopropyl sephadex)

D. pI = 10.5 QAE-sephadex (Quaternary amine sephadex)

5. (10 points) A protein sample elutes from an ion exchange column at a NaCl concentration of 1.2 M. The pooled protein has a volume of 50 mls (and a NaCl concentration of 1.2 M). We would like to proceed with the next step of purification, but first we must reduce the NaCl concentration to 5 mM. You will dialyze the sample versus water.

A. If you wanted to perform this dialysis in a single step, how large a volume of dialysis buffer (i.e. water) would you need?

B. If you only had a 1 liter sized container in which to perform the dialysis, how many dialysis steps would be required to get the final salt concentration less than or equal to 5mM (assume you can fit 2 liters of buffer and the sample in the container)?

6. (10 points) The bacteriophage M13 can infect only "male" E. coli cells, i.e. cells with a cellular structure called a pilus to which the M13 attaches in order to infect. The pilus in such cells forms in response to the presence of ‘F’ factor which is coded for by an extrachromosomal element known as an F’ episome. In order to work with M13, certain E. coli strains (e.g. JM101) have been developed in conjunction with F’ episomes in such a way that selective pressure exists to maintain these F’ episomes. Explain how this selective pressure works.

7. (15 points) An investigator is performing a SELEX type experiment. The would like to know what RNA sequences can bind to bacteriophage M2 RNA polymerase. They have a putative promoter region for M2 RNA polymerase:

5’ GACTGAAGACGGCTCCAGGT 3’

and have identified a critical region of six contiguous nucleotides (GACGGC, underlined above) which they will randomize. Since all possible sequences at this site would constitute 4⁶ , or 4096 uniques sequences, they will initial construct a library containing all these sequences. The figure below shows sequence information for the starting library and after three rounds of enrichment (selecting RNA’s which bind the polymerase). What is your conclusion from this data?