BCH 5425 Molecular Biology and Biotechnology
Spring 1999
Monday April 5
NAME:________________
Exam III (100 Points)
1. (10 points) List the main parameters that influence the migration rate of DNA through agarose gels. For each parameter describe all relevant information or quantitative relationship.
a. Molecular size of DNA: the migration rate is inversely proportional to the log of the molecular mass
b. The agarose concentration: the log of the migration rate is inversely proportional to the gel concentration
c. The conformation of the DNA: supercoiled (form I) migrates fastest, linear (form III) migrates slowest
d. The applied voltage: usually run at 5 Volts / cm
2. (10 points) A series of protein molecular weight standards are run on an acrylamide gel with the following results:
|
Protein |
Molecular Mass (KDa) |
Migration (cm) |
|
Phosphorylase B |
92 |
1.11 |
|
Bovine Serum Albumin |
68 |
1.72 |
|
Carbonic Anhydrase |
31 |
3.34 |
|
Soybean Trypsin Inhibitor |
22 |
4.24 |
|
a -Lactalbumin |
14 |
5.05 |
An unknown protein is run on the same gel and migrates 2.58 cm.
What is the Molecular Mass of the unknown protein? (use graph paper on back - SHOW YOUR WORK CLEARLY)

log(mw) = 4.64
mw = 43.7 KDa
3. (10 points) A 41 basepair DNA fragment is sequenced using dideoxy sequencing and the following sequencing primers:

The sequencing gels for each sequencing primer are as follows:

What is the sequence of the 41 basepair DNA fragment?
GAACTTCCGTAAGGAACTAGACTCTACGGAAGTACCTACAT
4. (5 points) A given PCR experiment starts with 1.2 nmoles of a duplex DNA fragment and proceeds for 10 cycles. What are the concentrations of each of the following oligonucleotides?

A. 1.2 nm or (1*x) times concentration
B. 1.2 nm
C. 12 nm or (n*x) times concentration
D. 12 nm
E. 1216 nm or (2n -(n+1)) times concentration
F. 1216 nm
5. (5 points) For the PCR experiment described in problem #4 the desired PCR product will be a DNA duplex of defined length (defined by the location of the PCR primers). However, the yield of this duplex will be lower than the actual concentration of defined length oligonucleotides. Why will this be so?
The other products (original template plus PCR products with undefined 3' ends will hybridize with the defined length PCR products. This will result in a duplex which is not the desired product.
In other words, the (1*x) plus (n*x) products can participate with the (2n -(n+1)) products to form non-desirable duplexes. This works out to be: (2n -(n+1)) - (n+1) or (2n - 2(n+1)). This can also be abbreviated as (2n - 2n). Thus, the concentration of desired duplex product will be 1216 - (1.2+12) = 1203 nmoles (the abbreviated calculation yields 1204 nmoles).
6. (5 points) What are the various steps in a single PCR cycle?
a. denaturation of template
b. annealing of primers
c. extension of primers
7. (10 points) For the following PCR primer determine values for Tm, Tms and Tmp values in 0.15M NaCl
5’ CGTGCAAGAGCGTGACTCAGTGA 3’
Tm: 72
Tms: 64.9
Tmp: 74.6
8. (15 points) Diagram and explain how you would use PCR to add EcoR I half-sites to a DNA fragment for the purpose of subcloning into a vector polylinker region. Apart from the 5' and 3' ends of the DNA fragment, you do not know anything about the internal sequence of the fragment.

9. (15 points) Draw a pUC vector. Diagram all the important elements of this vector and explain their function. If the function of these elements require specific properties of the host or growth media then explain these properties.

10. (15 points) Diagram how you would make a cDNA library starting from eukaryotic mRNA. Include all step, enzymes, etc. Assume that you will use homo-polymeric tailing to insert the cDNA into your vector.
