1

BCH 5425 Molecular Biology and Biotechnology

Spring 1998

Exam II (100 Points)

1. (5 points) For the following characteristics or conventions used to classify a bacterium, indicate whether the characteristic would most likely be associated with Family, Genus, Species or Strain distinctions (circle one choice for each).

A. Similar reaction to specific dyes:	Family		Genus		Species		Strain 
B. Mutations within a single gene: 	Family		Genus		Species		Strain
C. Chemical activities			Family		Genus		Species		Strain
D. E. coli (JM109)			Family		Genus		Species		Strain
E. E. coli (JM109)			Family		Genus		Species		Strain

2. (5 points) For the following molecules, indicate which ones can most likely pass freely through the cytoplasmic membrane:

A. O₂		Pass		Must be transported
B. Cl^-		Pass		Must be transported
C. H₂O		Pass		Must be transported
D. Na⁺		Pass		Must be transported
E. Acetic acid 	Pass		Must be transported

3. (5 points) Name the following components found in a gram negative cell wall.

Lipopolysaccharide

Braun lipoprotein

Phospholipid

Outer membrane

Peptidoglycan layer

4. (5 points) For a certain peritrichous bacteria it is observed that each flagella spends 30% of the time rotating clockwise and 70% of the time counterclockwise. If the bacteria has 9 flagella, what proportion of its time does it spend in "tumbling" behavior?

Swims (0.7)⁹ = 0.04 (4% of time)

Therefore, tumbles 96% of the time

5. (5 points) For the five choices, A-E, indicate the best match with the following characteristics of bacteria

Mesophiles		Faculative anaerobes	Acidophiles		Xenophobes
Faculative aerobes	Psychrophiles		Alkalophiles		Obligate aerobes
Halophiles		Hydrophobes 		Thermophiles		Halophobes


A. Optimum growth temp is >45°C					Thermophiles
B. Human pathogenic bacteria					Mesophiles
C. Found growing in frigid polar seas		 		Psychrophiles
D. Can grow in the presence of high concentrations of NaCl	Halophiles
E. Normally grows in presence of O₂ but can tolerate lack of O₂	Faculative anaerobes

6. You perform a bacterial growth curve experiment in liquid media and obtain the following data points: (note: there is a blank sheet at the end of the test for scratch work)

Time	A600
8:00 a.m.	0.103
8:30 a.m.	0.105
9:00 a.m.	0.144
9:30 a.m.	0.198
10:00 a.m.	0.291
10:30 a.m.	0.425
11:00 a.m.	0.612
11:30 a.m.	0.897
12:00 p.m.	1.43
12:30 p.m.	2.12
1:00 p.m.	2.42
1:30 p.m.	2.62
2:00 p.m.	2.78
2:30 p.m.	2.85
3:00 p.m.	2.87
3:30 p.m.	2.89
4:00 p.m.	2.9

A (5 points) What is the lag time of the culture growth?

30 min

B. (5 points) Over what time points is the growth exponential (i.e. "log phase" growth)?

30 - 270 minutes (8:30 - 12:30)

C. (5 points) If you wanted to sample the culture at ½ stationary phase, what would be the expected A₆₀₀ and at what time would you take the sample?

A₆₀₀ ~ 2.9. ½ stationary at A₆₀₀ ~1.45, or ~ 12:00 p.m.

D. (5 points) What is the doubling time of the culture for the "log phase" growth?

54.9 minutes

E. (5 points) Based on the doubling time, diagram the consecutive rounds of replication with regard to the cell growth parameters I, C, and D. (i.e. draw I, C, D vectors, no need to draw cells & chromosomes). Define I, C and D parameters.

C is the period during which chromosomal replication occurs

D is the period in which the septum forms, and cell division occurs at the end of the D period

I is the period between each successive initiation of chromosomal replication

7. (5 points) If you wanted to create a stable extrachromosomal element (i.e. plasmid) in a bacteria such as E. coli, describe the essential features you would need to combine to construct the plasmid. Describe the conditions under which the plasmid would remain a stable extrachromosomal element.

A. You would need an origin of replication (ori) and some kind of selection marker

B. If the selection marker were drug resistance, then the media would need to contain the drug. If the selection marker were an essential gene, then the host required would need to be deficient

8. (5 points) What is ampicillin and how does it work? What is the mechanism by which bacterial cells are rendered resistant to ampicillin?

Ampicillin binds to and inhibits a number of enzymes in the bacterial membrane that are involved in the synthesis of the gram negative cell wall.

Therefore, proper cell replication cannot occur in the presence of ampicillin.

The ampicillin resistance gene (amp^r) codes for an enzyme (b-lactamase) that is secreted into the periplasmic space of the bacterium where it catalyzes hydrolysis of the b-lactam ring of the ampicillin.

Thus, the gene product of the amp^r gene destroys the antibiotic.

9. (5 points) You perform an experiment similar to Korana (1963). The following polyribonucleotides when translated in vitro result in the following polypeptides:

AGAGAGAGA		Poly Glutamate (E), Poly Arginine (R)
AGGAGGAGG		Poly Glutamate (E), Poly Arginine (R), Poly Glycine (G) 
AAGAAGAAG		Poly Arginine (R), Poly Lysine (K), Poly Glutamate (E)
AAAAAAAAA		Poly Lysine (K)
GGGGGGGGG		Poly Glycine (G)

What is the most likely amino acid assignment for the following codons:

AGA		ARG
AGG		ARG
GAG		GLU
GGA		GLY
AAG		LYS

10. (10 points) Define the following terms:

A. Gene

The entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide or RNA molecule

B. Promoter

Region of a gene which binds RNA polymerase to initiate transcription

C. Operon

In bacterial DNA, a cluster of contiguous genes transcribed from one promoter that gives rise to a polycistronic mRNA.

D. Operator

Region of gene which binds regulator molecule which serves to regulate transcription (positive or negative control)

E. Polycistronic

Single mRNA molecule transcribed from an operon which encode two or more proteins typically with relationships in a metabolic pathway.

11. (10 points) Given the following information, fill in the blanks in the table

*Media:*	Glucose	Glucose + Lactose	Lactose	Glucose	Glucose	Glucose	Glucose + Lactose	Glucose + Lactose	Glucose + Lactose
Additive:	(none)	(none)	(none)	IPTG	dibutyryl cAMP	IPTG + dibutyryl cAMP	IPTG	dibutyryl cAMP	IPTG + dibutyryl cAMP
copies of lacZYA mRNA:	5	20	5000	20	5	5000	20	5000	5000

12. (10 points) Somewhere in the following DNA sequences is a Promoter region and a Rho- transcription terminator site. Identify where they are. For the terminator site, indicate the bases forming the stem/loop structure and site of termination. For the promoter, identify all appropriate regions, including transcription start site.

GCTACGATTGACATACCGTAGCGATGAACTATAATGCATTCGA

     -35 region            -10 region   +1
GCTACGATTGACATACCGTAGCGATGAACTATAATGCATTCGA

CTACGATACGCTACCCACUTACGAGUGGGUUUUCGATCCTA

              stem loop stem    x(stop)
CTACGATACGCTACCCACUTACGAGUGGGUUUUCGATCCTA

13. (5 points) List the possible base pairing configurations for mRNA and tRNA at the "wobble" position. Indicate whether there is a restriction on the location of a particular base.

A U, I

C G, I

G C, U

U A, I, G

Where U, G, A and C can be in either the codon (mRNA) or anti-codon (tRNA)

I (inosine) can be found in the anti-codon.