BCH 5425 Molecular Biology and Biotechnology
Spring 1998
Exam II (100 Points)
1. (5 points) For the following characteristics or conventions used to classify a bacterium, indicate whether the characteristic would most likely be associated with Family, Genus, Species or Strain distinctions (circle one choice for each).
A. Similar reaction to specific dyes: Family Genus Species Strain B. Mutations within a single gene: Family Genus Species Strain C. Chemical activities Family Genus Species Strain D. E. coli (JM109) Family Genus Species Strain E. E. coli (JM109) Family Genus Species Strain
2. (5 points) For the following molecules, indicate which ones can most likely pass freely through the cytoplasmic membrane:
A. O2 Pass Must be transported B. Cl- Pass Must be transported C. H2O Pass Must be transported D. Na+ Pass Must be transported E. Acetic acid Pass Must be transported
3. (5 points) Name the following components found in a gram negative cell wall.

4. (5 points) For a certain peritrichous bacteria it is observed that each flagella spends 30% of the time rotating clockwise and 70% of the time counterclockwise. If the bacteria has 9 flagella, what proportion of its time does it spend in "tumbling" behavior?
5. (5 points) For the five choices, A-E, indicate the best match with the following characteristics of bacteria
Mesophiles Faculative anaerobes Acidophiles Xenophobes Faculative aerobes Psychrophiles Alkalophiles Obligate aerobes Halophiles Hydrophobes Thermophiles HalophobesA. Optimum growth temp is >45°C B. Human pathogenic bacteria C. Found growing in frigid polar seas D. Can grow in the presence of high concentrations of NaCl E. Normally grows in presence of O2 but can tolerate lack of O2
6. You perform a bacterial growth curve experiment in liquid media and obtain the following data points: (note: there is a blank sheet at the end of the test for scratch work)
|
Time |
A600 |
|
8:00 a.m. |
0.103 |
|
8:30 a.m. |
0.105 |
|
9:00 a.m. |
0.144 |
|
9:30 a.m. |
0.198 |
|
10:00 a.m. |
0.291 |
|
10:30 a.m. |
0.425 |
|
11:00 a.m. |
0.612 |
|
11:30 a.m. |
0.897 |
|
12:00 p.m. |
1.43 |
|
12:30 p.m. |
2.12 |
|
1:00 p.m. |
2.42 |
|
1:30 p.m. |
2.62 |
|
2:00 p.m. |
2.78 |
|
2:30 p.m. |
2.85 |
|
3:00 p.m. |
2.87 |
|
3:30 p.m. |
2.89 |
|
4:00 p.m. |
2.9 |
A (5 points) What is the lag time of the culture growth?
B. (5 points) Over what time points is the growth exponential (i.e. "log phase" growth)?
C. (5 points) If you wanted to sample the culture at ½ stationary phase, what would be the expected A600 and at what time would you take the sample?
D. (5 points) What is the doubling time of the culture for the "log phase" growth?
E. (5 points) Based on the doubling time, diagram the consecutive rounds of replication with regard to the cell growth parameters I, C, and D. (i.e. draw I, C, D vectors, no need to draw cells & chromosomes). Define I, C and D parameters.
7. (5 points) If you wanted to create a stable extrachromosomal element (i.e. plasmid) in a bacteria such as E. coli, describe the essential features you would need to combine to construct the plasmid. Describe the conditions under which the plasmid would remain a stable extrachromosomal element.
8. (5 points) What is ampicillin and how does it work? What is the mechanism by which bacterial cells are rendered resistant to ampicillin?
9. (5 points) You perform an experiment similar to Korana (1963). The following polyribonucleotides when translated in vitro result in the following polypeptides:
AGAGAGAGA Poly Glutamate (E), Poly Arginine (R) AGGAGGAGG Poly Glutamate (E), Poly Arginine (R), Poly Glycine (G) AAGAAGAAG Poly Arginine (R), Poly Lysine (K), Poly Glutamate (E) AAAAAAAAA Poly Lysine (K) GGGGGGGGG Poly Glycine (G)
What is the most likely amino acid assignment for the following codons:
AGA AGG GAG GGA AAG
10. (10 points) Define the following terms:
A. Gene
B. Promoter
C. Operon
D. Operator
E. Polycistronic
11. (10 points) Given the following information, fill in the blanks in the table
|
Media: |
Glucose |
Glucose + Lactose |
Lactose |
Glucose |
Glucose |
Glucose |
Glucose + Lactose |
Glucose + Lactose |
Glucose + Lactose |
|
Additive: |
(none) |
(none) |
(none) |
IPTG |
dibutyryl cAMP |
IPTG + dibutyryl cAMP |
IPTG |
dibutyryl cAMP |
IPTG + dibutyryl cAMP |
|
copies of lacZYA |
5 |
20 |
5000 |
|
|
|
|
|
|
12. (10 points) Somewhere in the following DNA sequences is a Promoter region and a Rho- transcription terminator site. Identify where they are. For the terminator site, indicate the bases forming the stem/loop structure and site of termination. For the promoter, identify all appropriate regions, including transcription start site.
GCTACGATTGACATACCGTAGCGATGAACTATAATGCATTCGA
CTACGATACGCTACCCACUTACGAGUGGGUUUUCGATCCTA
13. (5 points) List the possible base pairing configurations for mRNA and tRNA at the "wobble" position. Indicate whether there is a restriction on the location of a particular base.