BCH 5425 Molecular Biology and Biotechnology

Spring 1998

1. (5 points) For the following characteristics or conventions used to classify a bacterium, indicate whether the characteristic would most likely be associated with Family, Genus, Species or Strain distinctions (circle one choice for each).

A. Similar reaction to specific dyes:	Family		Genus		Species		Strain 
B. Mutations within a single gene: 	Family		Genus		Species		Strain
C. Chemical activities			Family		Genus		Species		Strain
D. E. coli (JM109)			Family		Genus		Species		Strain
E. E. coli (JM109)			Family		Genus		Species		Strain

2. (5 points) For the following molecules, indicate which ones can most likely pass freely through the cytoplasmic membrane:

A. O2		Pass		Must be transported
B. Cl-		Pass		Must be transported
C. H2O		Pass		Must be transported
D. Na+		Pass		Must be transported
E. Acetic acid 	Pass		Must be transported

3. (5 points) Name the following components found in a gram negative cell wall.

4. (5 points) For a certain peritrichous bacteria it is observed that each flagella spends 30% of the time rotating clockwise and 70% of the time counterclockwise. If the bacteria has 9 flagella, what proportion of its time does it spend in "tumbling" behavior?

5. (5 points) For the five choices, A-E, indicate the best match with the following characteristics of bacteria

Mesophiles		Faculative anaerobes	Acidophiles		Xenophobes
Faculative aerobes	Psychrophiles		Alkalophiles		Obligate aerobes
Halophiles		Hydrophobes 		Thermophiles		Halophobes


A. Optimum growth temp is >45°C					
B. Human pathogenic bacteria					
C. Found growing in frigid polar seas		 		
D. Can grow in the presence of high concentrations of NaCl	
E. Normally grows in presence of O2 but can tolerate lack of O2	 

6. You perform a bacterial growth curve experiment in liquid media and obtain the following data points: (note: there is a blank sheet at the end of the test for scratch work)

A (5 points) What is the lag time of the culture growth?

B. (5 points) Over what time points is the growth exponential (i.e. "log phase" growth)?

C. (5 points) If you wanted to sample the culture at ½ stationary phase, what would be the expected A₆₀₀ and at what time would you take the sample?

D. (5 points) What is the doubling time of the culture for the "log phase" growth?

E. (5 points) Based on the doubling time, diagram the consecutive rounds of replication with regard to the cell growth parameters I, C, and D. (i.e. draw I, C, D vectors, no need to draw cells & chromosomes). Define I, C and D parameters.

7. (5 points) If you wanted to create a stable extrachromosomal element (i.e. plasmid) in a bacteria such as E. coli, describe the essential features you would need to combine to construct the plasmid. Describe the conditions under which the plasmid would remain a stable extrachromosomal element.

8. (5 points) What is ampicillin and how does it work? What is the mechanism by which bacterial cells are rendered resistant to ampicillin?

9. (5 points) You perform an experiment similar to Korana (1963). The following polyribonucleotides when translated in vitro result in the following polypeptides:

AGAGAGAGA		Poly Glutamate (E), Poly Arginine (R)
AGGAGGAGG		Poly Glutamate (E), Poly Arginine (R), Poly Glycine (G) 
AAGAAGAAG		Poly Arginine (R), Poly Lysine (K), Poly Glutamate (E)
AAAAAAAAA		Poly Lysine (K)
GGGGGGGGG		Poly Glycine (G)

What is the most likely amino acid assignment for the following codons:

AGA		
AGG		
GAG		
GGA		
AAG		

10. (10 points) Define the following terms:

A. Gene

B. Promoter

C. Operon

D. Operator

E. Polycistronic

11. (10 points) Given the following information, fill in the blanks in the table

12. (10 points) Somewhere in the following DNA sequences is a Promoter region and a Rho- transcription terminator site. Identify where they are. For the terminator site, indicate the bases forming the stem/loop structure and site of termination. For the promoter, identify all appropriate regions, including transcription start site.

GCTACGATTGACATACCGTAGCGATGAACTATAATGCATTCGA

CTACGATACGCTACCCACUTACGAGUGGGUUUUCGATCCTA

13. (5 points) List the possible base pairing configurations for mRNA and tRNA at the "wobble" position. Indicate whether there is a restriction on the location of a particular base.